Universal Adapter PCR Primers Multiplex Oligos 1 For Illumina K002-A

Multiplex Oligos 1 for Illumina

【Product Name】

Multiplex Oligos 1 for Illumina

【Cat. No./Spec.】

K002-A/192 rxns

【Product Description】

#K002-A Multiplex Oligos 1 for Illumina includes the universal adapter as well as 8 i5 PCR Primers and 12 i7 PCR Primers, each containing 8 nt index, allowing the construction of 96 different combinations of unique dual index libraries. When used with #K002-B Multiplex Oligos 2 for Illumina, 384 different combinations of dual index libraries can be constructed.

【Storage Condition & Shelf Life】

All reagents should be stored at -20°C. The product is valid for 12 months.

Do not premix Adapter, Ligation Buffer and DNA Ligase before use to avoid formation of excessive Adapter dimer.

【Scope of application】

This product is a special adapter primer kit for # K001 Fast DNA Library Prep Kit, which is applicable for Illumina platform.

Sequence Information

Adapter:

5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’

5’-GATCGGAAGAGCACACGTCTGAACTCCAGTC-3’

i5 PCR Primer:

5’-AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTACACGACGCT

C-3’

i7 PCR Primer:

5’-CAAGCAGAAGACGGCATACGAGAT[i7]GTGACTGGAGTTCAGACGTGTGCTCT-3’